RNA extraction using Qiazol
Take the normal(N1-N4) and tumor organoids(T1-T4) from -80°C along with a small piece of normal tissue(N) (20-30mg) and tumor tissue(T).
- Add 1 mL of Qiazol Reagent to lyze samples and homogenize by pipetting up and down. Incubate for 5min to permit complete dissociation of the nucleoproteins complex.
- Add 0.2 mL of chloroform per 1 mL of Qiazol Reagent used for lysis, then securely cap the tube. Incubate for 2–3min. Centrifuge the sample for 15min at 12,000 × g at 4°C. The mixture separates into a lower red phenol-chloroform, and interphase, and a colorless upper aqueous phase. Transfer the aqueous phase containing the RNA to a new tube by angling the tube at 45° and pipetting the solution out.
- Add 0.5 mL of isopropanol to the aqueous phase, per 1 mL of Qiazol Reagent used for lysis. Incubate for 10min. Centrifuge for 10min at 12,000 × g at 4°C.
- Discard the supernatant and resuspend the pellet in 1 mL of 75% ethanol per 1 mL of Qiazol Reagent used for lysis. Vortex briefly, centrifuge for 5 min at 7500 × g at 4°C. Discard the supernatant and vacuum or air dry the RNA pellet for 5–10 min. Resuspend the pellet in 20–50 μL of RNase-free water. Incubate in a water bath or heat block set at 55–60°C for 10–15 min. Determine the RNA yield and purity using Nanodrop.
- Calculate the RNA concentration using the formula A260 × dilution × 40 = μg RNA/mL. Calculate the A260/A280 ratio. A ratio of ~2 is considered pure N1(96 ng/ul), N2(167 ng/ul), N3(161 ng/ul), N4(137 ng/ul) T1(47 ng/ul), T2(52 ng/ul), T3(19 ng/ul), T4(47 ng/ul) N( 3894 ng/ul), T( 2648 ng/ul)
RT PCR
- Program the thermal cycler so that cDNA synthesis is followed immediately by PCR amplification, as follows: cDNA synthesis and pre-denaturation, 1X, 55°C for 30 min, 94°C for 2 min PCR: 40X cycle, 94°C for 15 seconds, 60°C for 30 seconds, 68°C for 4 min(1min/kb) Final extention (optional): 1X, 68°C for 5 min
Add the following to a thin-walled PCR tube on ice. 2X Reaction Mix(12.5μL), Template RNA (200ng), Sense primer,10 μM (0.5 μL), Anti-sense primer,10 μM(0.5 μL), SuperScriptTM III RT/PlatinumTM Taq Mix (1μL), Autoclaved distilled water(Till 25 μL)
Primer pairs: DNAJB1 ex1& PRKACA ex3 , GAPDH (control)
DNAJB1-exon1-F: GTTCAAGGAGATCGCTGAGG
PRKACA-exon3-R: TTCCCGGTCTCCTTGTGTTT
- Verify the absence of genomic DNA in RNA preparations using One taq master mix plus GAPDH primer pairs and RNA (NO RT control).
- Gently mix and make sure that all the components are at the bottom of the tube. Centrifuge briefly.
- Place the reaction in the preheated thermal cycler programmed as described above. Load it on the 1% agarose gel and analyze the results.
