RNA was previously extracted from organoids and tissues: https://macromolecule-child.rockefeller.edu/#20210720%20RT%20PCR-%20DNAJB1-PRKACA
Program the thermal cycler so that cDNA synthesis is followed immediately by PCR amplification, as follows: cDNA synthesis and pre-denaturation>> 1X, 55°C for 15 min, 94°C for 2 min TD-PCR>>15X cycles: 94°C for 15 seconds, 65°C(Tm+10) for 30 seconds (-1°C per cycle), 68°C for 1 min(1min/kb),+15X cycles: 94°C for 30 seconds, 50°C(Tm-5) for 30 seconds, 68°C for 1 min(1min/kb), Final extention (optional): 1X, 68°C for 5 min, 4°C for 15 min, 23°C/RT forever.
Add the following to a thin-walled PCR tube on ice. 2X Reaction Mix(12.5μL), Template RNA (200ng), Sense primer-10 μM (0.5 μL), Anti-sense primer-10 μM(0.5 μL), SuperScriptTM III RT/PlatinumTM Taq Mix (0.5μL), Autoclaved distilled water(Till 25 μL)
Primer pairs: DNAJB1 ex1& PRKACA ex3
DNAJB1-exon1-F: GTTCAAGGAGATCGCTGAGG
PRKACA-exon3-R: TTCCCGGTCTCCTTGTGTTT
- Gently mix and make sure that all the components are at the bottom of the tube. Centrifuge briefly.
- Place the reaction in the preheated thermal cycler programmed as described above. Load it on the 2% agarose gel and analyze the results.
