LaCava Research Wiki

Initiated September 2017

FLC Lentivirus plasmid cloning Sept 2021

admin16th October 2021 at 1:41pm

Lenti-Design

- To make the transgene overexpression vector pMT878 - 4 piece gibson

1. Start with pEF182, cut XbaI-EcoRV (remove mScarlet…3xFlag)

2. EF-1a- from a vector - primer 3 + 12 (MTp487+MTp500, 1229 bp)

3. Gene blocks to have the rest, three pieces:

  • MTp483_tdTomato-P2A-PuroR (gBlock)– primers 1+2 (MTp485+MTp486, 2085 bp)
  • MTp484_Dnajb1-Prkaca-3C-3xF (gBlock)– primers 11 +4 (MTp488+MTp499, 1364 bp)

- To make the dual guide lenti pMT879- 4 piece gibson

1. Start with pEF182, cut EcoRI-EcoRV (remove EFS-NS…3xFlag)

2. Geneblocks have the rest, three pieces:

  • MTp495_Guide1_gBlock (primers 5+13 (MTp489-497, 768 bp)
  • MTp496_Guide 2_gBlock (EFS-NS – primers 14+6 (MTp490+498 408 bp)
  • MTp483 tdTomato-P2A-PuroR – primers 7+8 (MTp491+492, 2088 bp)

- To make the dual guide + cas9 lenti pMT880 - 2 piece gibson

1. start with pEF37 cut with BsmBI

2. PCR MTp495_Guide1_gBlock (primers 9+13 (MTp493-497, 508 bp)

Fragment PCR with KAPA HiFi HotStart ReadyMix using the primers below (according to the instructions above):

PRIMERS

  1. MTp485 EFS-NS-tdTomato-Fwd gccagaacacaggaccggttctagaGCCACCatggtgagcaagggcgag
  2. MTp486 PuroR-EF-1a-Rev ccactgacgggcaccggagCTTAtcaggcaccgggcttgc
  3. MTp487 EF1a-Fwd gcaagcccggtgcctgaTAAGctccggtgcccgtcagtgg
  4. MTp488 3xF-WPRE-Rev tggccaacatggccGATATCGGTACCTTACTActtgtcatcgtcatccttgtaatcg
  5. MTp489 UCOE-Guides-Fwd Tgtaggcgcggagtatcgagaattcgctagcgctagcgagggcctatttccc
  6. MTp490 EFS-NS-Rev tcctcgcccttgctcaccatGGTGGCtctagaaccggtcctgtgttctg
  7. MTp491 tdTomato-EFSNS-Fwd cagaacacaggaccggttctagaGCCACCatggtgagcaagggcgagga
  8. MTp492 PuroR-WPRE-Rev tggccaacatggccGATATCTTAtcaggcaccgggcttgc
  9. MTp493 hU6-sg1-Fwd atatcttGTGGAAAGGACGAAACACCGACCCGCCGTTTGACAGG
  10. MTp494 DualGuide-Rev taacggGTACtcaagacctagctagccaattcccactcctttcaagaccta
  11. MTp499 Dnajb1-Fwd ATGGGTAAAGACTACTACCAGACGTTG
  12. MTp500 EF1a-Dnajb1_Rev CAACGTCTGGTAGTAGTCTTTACCCATtcacgacacctgaaatggaagaaaaaaac
  13. MTp497 Guide1_Rev gctgTTTCcagcaTAGCTCTtAAACCGCTGATTCTCACTAGCCACac
  14. MTp498 Guide2_Fwd gtGTGGCTAGTGAGAATCAGCGGTTTaAGAGCTAtgctgGAAAcagc

Gibson assembly using the: NEBuilder® HiFi DNA Assembly Master Mix

To conserve material i scaled it down to 1:4 (total volume: 5ul)

Bacterial Transformation

Add 0,4 ul of β-ME to each aliquot of cells. (the ratio is 1:25, so 0,4ul for 10ul of cells, 4 ul for 100 ul).

Mix the tubes by gently flicking. Incubate cells on ice for 10 minutes, flicking tubes gently every 2 minutes.

Used 2.5ul of the ligation for transforming competent cells.

Make sure you label your tubes if you are transforming multiple plasmids! Mix (or flick) gently then incubate on ice for 30 minutes.

Heat-pulse the tubes for 30 seconds (exactly) in 42°C water bath or heat block filled with water.

Immediately move cells to ice for 2-minute recovery incubation.

Add ~1ml of LB (RT or pre-heated, but not cold) to each tube. Incubate for 1 hour at 37°C with shaking (200-250 rpm). This step is not critical, some people skip it. But if you skip it your cells will grow more slowly. If you can do an incubation for at least 15 minutes it will speed up cell growth.

Plate <200ul of transformation mixture on pre-warmed LB agar plates containing appropriate antibiotic (usually Ampicillin/Carbenicillin). For Line 1 plasmids in XL-10 gold cells, 10-50ul is more than enough. Save remaining cell mixture at 4°C and re-plate the next day if necessary. You can use glass plating beads or an inoculation loop for plating.

Incubate plates at 37°C overnight. Remove plates the next day and seal with parafilm. They can be stored for a day at RT on your bench or at 4° for long periods of time.

Colony PCRs

Once bacteria grow, i did colony PCRs