LaCava Research Wiki

Summary of the FLC lentivirus transfer constructs

1st construct - pMT878

Between the LTRs this vector has:

1. Ectopic expression of Dnajb1-Prkaca-3C-3xF under the EF1a promoter

2. No poly-A added

3. tdTomato-P2A-PuroR selection cassette 4. A ubiquitous chromatin opening element (UCOE) element to help keep our inserted transgene from getting silenced

5. Central polypurine tract (CPPT) to increase lentivirus-mediated gene transfer efficiency

6. Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) to increase expression and stability of gene delivered by viral vectors

2nd construct - pMT879 (can be used with an integration-deficient lenti to avoid chronic expression of guides)

Between the LTRs this vector has:

1. Sg1 (targets DNAJB1) and sg2 (targets PRKACA) for generation of Dnajb1-Prkaca fusion

2. No poly-A added

3. tdTomato-P2A-PuroR selection cassette

4. A ubiquitous chromatin opening element (UCOE) element to help keep our inserted transgene from getting silenced

5. Central polypurine tract (CPPT) to increase lentivirus-mediated gene transfer efficiency

6. Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) to increase expression and stability of gene delivered by viral vectors

3rd construct - pMT880 (gives us flexibility-no need for Cas9 mice/organoids)

1. Sg1 (targets DNAJB1) and sg2 (targets PRKACA) for generation of Dnajb1-Prkaca fusion Cas9-T2A-eGFP

Cloning strategy: Gibson + gene block synthesis

- To make the transgene overexpression vector pMT878

1. Start with pEF182, cut XbaI-EcoRV (remove mScarlet…3xFlag)

2. EF-1a- from a vector -> primer 3 + 12 (MTp487+MTp500, 1229 bp)

3. Gene blocks to have the rest, three pieces: MTp483_tdTomato-P2A-PuroR (gBlock)–> primers 1+2 (MTp485+MTp486, 2085 bp)

MTp484_Dnajb1-Prkaca-3C-3xF (gBlock)–> primers 11 +4 (MTp488+MTp499, 1364 bp)

- To make the dual guide lenti pMT879

1. Start with pEF182, cut EcoRI-EcoRV (remove EFS-NS…3xFlag)

2. Geneblocks have the rest, three pieces: MTp495_Guide1_gBlock ->primers 5+13 (MTp489-497, 768 bp)

MTp496_Guide 2_gBlock -> EFS-NS – primers 14+6 (MTp490+498 408 bp)

MTp483 tdTomato-P2A-PuroR –> primers 7+8 (MTp491+492, 2088 bp)

- To make the dual guide + cas9 lenti pMT880 – 2 piece gibson 1. start with pEF37 cut with BsmBI-NheI

2. PCR MTp495_Guide1_gBlock -> primers 9+13 (MTp493-497, 508 bp)

Cloning primers:

1. MTp485 EFS-NS-tdTomato-Fwd gccagaacacaggaccggttctagaGCCACCatggtgagcaagggcgag
2. MTp486 PuroR-EF-1a-Rev ccactgacgggcaccggagCTTAtcaggcaccgggcttgc
3. MTp487 EF1a-Fwd gcaagcccggtgcctgaTAAGctccggtgcccgtcagtgg
4. MTp488 3xF-WPRE-Rev tggccaacatggccGATATCGGTACCTTACTActtgtcatcgtcatccttgtaatcg
5. MTp489 UCOE-Guides-Fwd Tgtaggcgcggagtatcgagaattcgctagcgctagcgagggcctatttccc
6. MTp490 EFS-NS-Rev tcctcgcccttgctcaccatGGTGGCtctagaaccggtcctgtgttctg
7. MTp491 tdTomato-EFSNS-Fwd cagaacacaggaccggttctagaGCCACCatggtgagcaagggcgagga
8. MTp492 PuroR-WPRE-Rev tggccaacatggccGATATCTTAtcaggcaccgggcttgc
9. MTp493 hU6-sg1-Fwd atatcttGTGGAAAGGACGAAACACCGACCCGCCGTTTGACAGG
10. MTp494 DualGuide-Rev taacggGTACtcaagacctagctagccaattcccactcctttcaagaccta
11. MTp499 Dnajb1-Fwd ATGGGTAAAGACTACTACCAGACGTTG
12. MTp500 EF1a-Dnajb1_Rev CAACGTCTGGTAGTAGTCTTTACCCATtcacgacacctgaaatggaagaaaaaaac
13. MTp497 Guide1_Rev gctgTTTCcagcaTAGCTCTtAAACCGCTGATTCTCACTAGCCACac
14. MTp498 Guide2_Fwd gtGTGGCTAGTGAGAATCAGCGGTTTaAGAGCTAtgctgGAAAcagc